Review



blasticidin marker transfected construct  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88

    Structured Review

    Addgene inc blasticidin marker transfected construct
    Blasticidin Marker Transfected Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/blasticidin+marker+transfected+construct/untargeted+Aurora+B+FRET+sensor+Kif2+substrate+(Plasmid+%2345215)/10__7554_slash_elife__36392-259-71-87
    Average 88 stars, based on 2 article reviews
    blasticidin marker transfected construct - by Bioz Stars, 2026-09
    88/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments
    Article Snippet: .. Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) U2OS ATCC HTB-96 Transfected construct (Homo sapiens) pBABE-puro mTurquoise2-Nuf2 this paper Nuf2 N-terminally labeled with mTurquoise2; in retroviral vector with puromycin selection marker Transfected construct (Homo sapiens) pBABE-hygro mTurquoise2-Nuf2 this paper Same as above, but with hygromycin selection marker Transfected construct (Homo sapiens) pBABE-blast mTurquoise2-Nuf2 this paper Same as above, but with blasticidin marker Transfected construct (Homo sapiens) pBABE-blast Aurora B FRET sensor (mTurquoise2/YPet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) Nuf2-targeted Aurora B FRET sensor (mTurquoise2/Ypet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) mTurquoise2-TC this paper mTurquoise2 with tetracysteine motif at the C-terminus Transfected construct (Homo sapiens) WT-Hec1-LSSmOrange this paper modified from WT-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9A-Hec1-LSSmOrange this paper modified from 9A-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 2D(S44,55D)-Hec1 -LSSmOrange this paper modified from 2D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9D-Hec1-LSSmOrange this paper modified from 9D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) INCENP-mCherry other Gift from Michael Lampson Recombinant DNA reagent pSpCas9(BB) 2A-GFP (pX458) Ran et al. (2013) Addgene: #48138 Continued on next page Yoo et al. eLife 2018;7:e36392. .. DOI: https://doi.org/10.7554/eLife.36392 17 of 34 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Sequence-based reagent Donor single-stranded DNA for TC tag insertion at the C-terminus of TUBB IDT ssDNA: cgtctctgagtatcagcagtacca ggatgccaccgcagaagaggaggaggattt cggtgaggaggccgaagaggaggcctGCT GTCCCGGCTGTTGctaaggcagagcccc catcacctcaggcttctcagttcccttagccgtc ttactcaactgcccctttcctctccctcaga; sgRNA target sequence: GAGGCCGAA GAGGAGGCCTA Sequence-based reagent Hec1 siRNA Qiagen Cat#: SI02653567 Peptide, recombinant protein TC-peptide Genscript Custom designed Synthesized, Ac-AEEEACCPGCC-NH2 Commercial assay or kit Amaxa Cell Line Nucleofector Kit V Lonza Cat#:VCA-1003 Commercial assay or kit Ingenio Electroporation Kit Mirus Cat#: MIR 50118 Commercial assay or kit Lipofectamine RNAiMax Thermo Fisher Cat#:13778075 Chemical compound, drug FlAsH-EDT2 Thermo Fisher Cat#:T34561 Chemical compound, drug 1,2-Ethanedithiol (EDT) Alfa Aesar Cat#:540-63-6 Chemical compound, drug ZM447439 Enzo Life Sciences Cat#:BML-EI373 Chemical compound, drug Paclitaxel (Taxol) Enzo Life Sciences Cat#:BML-T104 Chemical compound, drug 5-iodotubercidin (5-ITu) Enzo Life Sciences Cat#:BML-EI29 Chemical compound, drug S-Trityl-L-cysteine Sigma Aldrich Cat#:164739–5G Chemical compound, drug Alexa Fluor 488 Thermo Fisher Cat#:A20000 Chemical compound, drug Sodium 2- mercaptoethanesulfonate Sigma Aldrich Cat#:M1511 Software, algorithm Interactive kinetochore FLIM-FRET analysis GUI (MATLAB 2016) This paper http://doi.org/10.5281/zenodo.1198705; copy archived at https://github.com/ elifesciences-publications/FLIMInteractive-Data-Analysis Software, algorithm Aurora B concentration at NDC80 analysis (Python 3) This paper http://doi.org/10.5281/zenodo.1198702; copy archived at https://github.com/ elifesciences-publications/Aurora ConcentrationAnalysis Software, algorithm CAMPARI (v2) Pappu Lab http://campari.sourceforge.net /V2/index.html Software, algorithm Rosetta 3.8 RosettaCommons RRID:SCR_015701 Other 25 mm #1.5 poly-D-lysine coated round coverglass neuVitro Cat#:GG-25–1.5-pdl Other FluoroBrite DMEM Thermo Fisher Cat#:A1896701 Other Microtubule structure Zhang et al. (2015) PDB 3JAS Other Human NDC80 bonsai decorated tubulin dimer Alushin et al. (2010) PDB 3IZ0 Other mTurquoise structure Stetten et al. (unpublished) PDB 4B5Y Yoo et al. eLife 2018;7:e36392.

    Construct:

    Article Title: Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments
    Article Snippet: .. Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) U2OS ATCC HTB-96 Transfected construct (Homo sapiens) pBABE-puro mTurquoise2-Nuf2 this paper Nuf2 N-terminally labeled with mTurquoise2; in retroviral vector with puromycin selection marker Transfected construct (Homo sapiens) pBABE-hygro mTurquoise2-Nuf2 this paper Same as above, but with hygromycin selection marker Transfected construct (Homo sapiens) pBABE-blast mTurquoise2-Nuf2 this paper Same as above, but with blasticidin marker Transfected construct (Homo sapiens) pBABE-blast Aurora B FRET sensor (mTurquoise2/YPet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) Nuf2-targeted Aurora B FRET sensor (mTurquoise2/Ypet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) mTurquoise2-TC this paper mTurquoise2 with tetracysteine motif at the C-terminus Transfected construct (Homo sapiens) WT-Hec1-LSSmOrange this paper modified from WT-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9A-Hec1-LSSmOrange this paper modified from 9A-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 2D(S44,55D)-Hec1 -LSSmOrange this paper modified from 2D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9D-Hec1-LSSmOrange this paper modified from 9D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) INCENP-mCherry other Gift from Michael Lampson Recombinant DNA reagent pSpCas9(BB) 2A-GFP (pX458) Ran et al. (2013) Addgene: #48138 Continued on next page Yoo et al. eLife 2018;7:e36392. .. DOI: https://doi.org/10.7554/eLife.36392 17 of 34 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Sequence-based reagent Donor single-stranded DNA for TC tag insertion at the C-terminus of TUBB IDT ssDNA: cgtctctgagtatcagcagtacca ggatgccaccgcagaagaggaggaggattt cggtgaggaggccgaagaggaggcctGCT GTCCCGGCTGTTGctaaggcagagcccc catcacctcaggcttctcagttcccttagccgtc ttactcaactgcccctttcctctccctcaga; sgRNA target sequence: GAGGCCGAA GAGGAGGCCTA Sequence-based reagent Hec1 siRNA Qiagen Cat#: SI02653567 Peptide, recombinant protein TC-peptide Genscript Custom designed Synthesized, Ac-AEEEACCPGCC-NH2 Commercial assay or kit Amaxa Cell Line Nucleofector Kit V Lonza Cat#:VCA-1003 Commercial assay or kit Ingenio Electroporation Kit Mirus Cat#: MIR 50118 Commercial assay or kit Lipofectamine RNAiMax Thermo Fisher Cat#:13778075 Chemical compound, drug FlAsH-EDT2 Thermo Fisher Cat#:T34561 Chemical compound, drug 1,2-Ethanedithiol (EDT) Alfa Aesar Cat#:540-63-6 Chemical compound, drug ZM447439 Enzo Life Sciences Cat#:BML-EI373 Chemical compound, drug Paclitaxel (Taxol) Enzo Life Sciences Cat#:BML-T104 Chemical compound, drug 5-iodotubercidin (5-ITu) Enzo Life Sciences Cat#:BML-EI29 Chemical compound, drug S-Trityl-L-cysteine Sigma Aldrich Cat#:164739–5G Chemical compound, drug Alexa Fluor 488 Thermo Fisher Cat#:A20000 Chemical compound, drug Sodium 2- mercaptoethanesulfonate Sigma Aldrich Cat#:M1511 Software, algorithm Interactive kinetochore FLIM-FRET analysis GUI (MATLAB 2016) This paper http://doi.org/10.5281/zenodo.1198705; copy archived at https://github.com/ elifesciences-publications/FLIMInteractive-Data-Analysis Software, algorithm Aurora B concentration at NDC80 analysis (Python 3) This paper http://doi.org/10.5281/zenodo.1198702; copy archived at https://github.com/ elifesciences-publications/Aurora ConcentrationAnalysis Software, algorithm CAMPARI (v2) Pappu Lab http://campari.sourceforge.net /V2/index.html Software, algorithm Rosetta 3.8 RosettaCommons RRID:SCR_015701 Other 25 mm #1.5 poly-D-lysine coated round coverglass neuVitro Cat#:GG-25–1.5-pdl Other FluoroBrite DMEM Thermo Fisher Cat#:A1896701 Other Microtubule structure Zhang et al. (2015) PDB 3JAS Other Human NDC80 bonsai decorated tubulin dimer Alushin et al. (2010) PDB 3IZ0 Other mTurquoise structure Stetten et al. (unpublished) PDB 4B5Y Yoo et al. eLife 2018;7:e36392.

    Labeling:

    Article Title: Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments
    Article Snippet: .. Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) U2OS ATCC HTB-96 Transfected construct (Homo sapiens) pBABE-puro mTurquoise2-Nuf2 this paper Nuf2 N-terminally labeled with mTurquoise2; in retroviral vector with puromycin selection marker Transfected construct (Homo sapiens) pBABE-hygro mTurquoise2-Nuf2 this paper Same as above, but with hygromycin selection marker Transfected construct (Homo sapiens) pBABE-blast mTurquoise2-Nuf2 this paper Same as above, but with blasticidin marker Transfected construct (Homo sapiens) pBABE-blast Aurora B FRET sensor (mTurquoise2/YPet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) Nuf2-targeted Aurora B FRET sensor (mTurquoise2/Ypet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) mTurquoise2-TC this paper mTurquoise2 with tetracysteine motif at the C-terminus Transfected construct (Homo sapiens) WT-Hec1-LSSmOrange this paper modified from WT-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9A-Hec1-LSSmOrange this paper modified from 9A-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 2D(S44,55D)-Hec1 -LSSmOrange this paper modified from 2D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9D-Hec1-LSSmOrange this paper modified from 9D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) INCENP-mCherry other Gift from Michael Lampson Recombinant DNA reagent pSpCas9(BB) 2A-GFP (pX458) Ran et al. (2013) Addgene: #48138 Continued on next page Yoo et al. eLife 2018;7:e36392. .. DOI: https://doi.org/10.7554/eLife.36392 17 of 34 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Sequence-based reagent Donor single-stranded DNA for TC tag insertion at the C-terminus of TUBB IDT ssDNA: cgtctctgagtatcagcagtacca ggatgccaccgcagaagaggaggaggattt cggtgaggaggccgaagaggaggcctGCT GTCCCGGCTGTTGctaaggcagagcccc catcacctcaggcttctcagttcccttagccgtc ttactcaactgcccctttcctctccctcaga; sgRNA target sequence: GAGGCCGAA GAGGAGGCCTA Sequence-based reagent Hec1 siRNA Qiagen Cat#: SI02653567 Peptide, recombinant protein TC-peptide Genscript Custom designed Synthesized, Ac-AEEEACCPGCC-NH2 Commercial assay or kit Amaxa Cell Line Nucleofector Kit V Lonza Cat#:VCA-1003 Commercial assay or kit Ingenio Electroporation Kit Mirus Cat#: MIR 50118 Commercial assay or kit Lipofectamine RNAiMax Thermo Fisher Cat#:13778075 Chemical compound, drug FlAsH-EDT2 Thermo Fisher Cat#:T34561 Chemical compound, drug 1,2-Ethanedithiol (EDT) Alfa Aesar Cat#:540-63-6 Chemical compound, drug ZM447439 Enzo Life Sciences Cat#:BML-EI373 Chemical compound, drug Paclitaxel (Taxol) Enzo Life Sciences Cat#:BML-T104 Chemical compound, drug 5-iodotubercidin (5-ITu) Enzo Life Sciences Cat#:BML-EI29 Chemical compound, drug S-Trityl-L-cysteine Sigma Aldrich Cat#:164739–5G Chemical compound, drug Alexa Fluor 488 Thermo Fisher Cat#:A20000 Chemical compound, drug Sodium 2- mercaptoethanesulfonate Sigma Aldrich Cat#:M1511 Software, algorithm Interactive kinetochore FLIM-FRET analysis GUI (MATLAB 2016) This paper http://doi.org/10.5281/zenodo.1198705; copy archived at https://github.com/ elifesciences-publications/FLIMInteractive-Data-Analysis Software, algorithm Aurora B concentration at NDC80 analysis (Python 3) This paper http://doi.org/10.5281/zenodo.1198702; copy archived at https://github.com/ elifesciences-publications/Aurora ConcentrationAnalysis Software, algorithm CAMPARI (v2) Pappu Lab http://campari.sourceforge.net /V2/index.html Software, algorithm Rosetta 3.8 RosettaCommons RRID:SCR_015701 Other 25 mm #1.5 poly-D-lysine coated round coverglass neuVitro Cat#:GG-25–1.5-pdl Other FluoroBrite DMEM Thermo Fisher Cat#:A1896701 Other Microtubule structure Zhang et al. (2015) PDB 3JAS Other Human NDC80 bonsai decorated tubulin dimer Alushin et al. (2010) PDB 3IZ0 Other mTurquoise structure Stetten et al. (unpublished) PDB 4B5Y Yoo et al. eLife 2018;7:e36392.

    Retroviral:

    Article Title: Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments
    Article Snippet: .. Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) U2OS ATCC HTB-96 Transfected construct (Homo sapiens) pBABE-puro mTurquoise2-Nuf2 this paper Nuf2 N-terminally labeled with mTurquoise2; in retroviral vector with puromycin selection marker Transfected construct (Homo sapiens) pBABE-hygro mTurquoise2-Nuf2 this paper Same as above, but with hygromycin selection marker Transfected construct (Homo sapiens) pBABE-blast mTurquoise2-Nuf2 this paper Same as above, but with blasticidin marker Transfected construct (Homo sapiens) pBABE-blast Aurora B FRET sensor (mTurquoise2/YPet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) Nuf2-targeted Aurora B FRET sensor (mTurquoise2/Ypet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) mTurquoise2-TC this paper mTurquoise2 with tetracysteine motif at the C-terminus Transfected construct (Homo sapiens) WT-Hec1-LSSmOrange this paper modified from WT-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9A-Hec1-LSSmOrange this paper modified from 9A-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 2D(S44,55D)-Hec1 -LSSmOrange this paper modified from 2D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9D-Hec1-LSSmOrange this paper modified from 9D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) INCENP-mCherry other Gift from Michael Lampson Recombinant DNA reagent pSpCas9(BB) 2A-GFP (pX458) Ran et al. (2013) Addgene: #48138 Continued on next page Yoo et al. eLife 2018;7:e36392. .. DOI: https://doi.org/10.7554/eLife.36392 17 of 34 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Sequence-based reagent Donor single-stranded DNA for TC tag insertion at the C-terminus of TUBB IDT ssDNA: cgtctctgagtatcagcagtacca ggatgccaccgcagaagaggaggaggattt cggtgaggaggccgaagaggaggcctGCT GTCCCGGCTGTTGctaaggcagagcccc catcacctcaggcttctcagttcccttagccgtc ttactcaactgcccctttcctctccctcaga; sgRNA target sequence: GAGGCCGAA GAGGAGGCCTA Sequence-based reagent Hec1 siRNA Qiagen Cat#: SI02653567 Peptide, recombinant protein TC-peptide Genscript Custom designed Synthesized, Ac-AEEEACCPGCC-NH2 Commercial assay or kit Amaxa Cell Line Nucleofector Kit V Lonza Cat#:VCA-1003 Commercial assay or kit Ingenio Electroporation Kit Mirus Cat#: MIR 50118 Commercial assay or kit Lipofectamine RNAiMax Thermo Fisher Cat#:13778075 Chemical compound, drug FlAsH-EDT2 Thermo Fisher Cat#:T34561 Chemical compound, drug 1,2-Ethanedithiol (EDT) Alfa Aesar Cat#:540-63-6 Chemical compound, drug ZM447439 Enzo Life Sciences Cat#:BML-EI373 Chemical compound, drug Paclitaxel (Taxol) Enzo Life Sciences Cat#:BML-T104 Chemical compound, drug 5-iodotubercidin (5-ITu) Enzo Life Sciences Cat#:BML-EI29 Chemical compound, drug S-Trityl-L-cysteine Sigma Aldrich Cat#:164739–5G Chemical compound, drug Alexa Fluor 488 Thermo Fisher Cat#:A20000 Chemical compound, drug Sodium 2- mercaptoethanesulfonate Sigma Aldrich Cat#:M1511 Software, algorithm Interactive kinetochore FLIM-FRET analysis GUI (MATLAB 2016) This paper http://doi.org/10.5281/zenodo.1198705; copy archived at https://github.com/ elifesciences-publications/FLIMInteractive-Data-Analysis Software, algorithm Aurora B concentration at NDC80 analysis (Python 3) This paper http://doi.org/10.5281/zenodo.1198702; copy archived at https://github.com/ elifesciences-publications/Aurora ConcentrationAnalysis Software, algorithm CAMPARI (v2) Pappu Lab http://campari.sourceforge.net /V2/index.html Software, algorithm Rosetta 3.8 RosettaCommons RRID:SCR_015701 Other 25 mm #1.5 poly-D-lysine coated round coverglass neuVitro Cat#:GG-25–1.5-pdl Other FluoroBrite DMEM Thermo Fisher Cat#:A1896701 Other Microtubule structure Zhang et al. (2015) PDB 3JAS Other Human NDC80 bonsai decorated tubulin dimer Alushin et al. (2010) PDB 3IZ0 Other mTurquoise structure Stetten et al. (unpublished) PDB 4B5Y Yoo et al. eLife 2018;7:e36392.

    Plasmid Preparation:

    Article Title: Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments
    Article Snippet: .. Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) U2OS ATCC HTB-96 Transfected construct (Homo sapiens) pBABE-puro mTurquoise2-Nuf2 this paper Nuf2 N-terminally labeled with mTurquoise2; in retroviral vector with puromycin selection marker Transfected construct (Homo sapiens) pBABE-hygro mTurquoise2-Nuf2 this paper Same as above, but with hygromycin selection marker Transfected construct (Homo sapiens) pBABE-blast mTurquoise2-Nuf2 this paper Same as above, but with blasticidin marker Transfected construct (Homo sapiens) pBABE-blast Aurora B FRET sensor (mTurquoise2/YPet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) Nuf2-targeted Aurora B FRET sensor (mTurquoise2/Ypet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) mTurquoise2-TC this paper mTurquoise2 with tetracysteine motif at the C-terminus Transfected construct (Homo sapiens) WT-Hec1-LSSmOrange this paper modified from WT-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9A-Hec1-LSSmOrange this paper modified from 9A-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 2D(S44,55D)-Hec1 -LSSmOrange this paper modified from 2D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9D-Hec1-LSSmOrange this paper modified from 9D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) INCENP-mCherry other Gift from Michael Lampson Recombinant DNA reagent pSpCas9(BB) 2A-GFP (pX458) Ran et al. (2013) Addgene: #48138 Continued on next page Yoo et al. eLife 2018;7:e36392. .. DOI: https://doi.org/10.7554/eLife.36392 17 of 34 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Sequence-based reagent Donor single-stranded DNA for TC tag insertion at the C-terminus of TUBB IDT ssDNA: cgtctctgagtatcagcagtacca ggatgccaccgcagaagaggaggaggattt cggtgaggaggccgaagaggaggcctGCT GTCCCGGCTGTTGctaaggcagagcccc catcacctcaggcttctcagttcccttagccgtc ttactcaactgcccctttcctctccctcaga; sgRNA target sequence: GAGGCCGAA GAGGAGGCCTA Sequence-based reagent Hec1 siRNA Qiagen Cat#: SI02653567 Peptide, recombinant protein TC-peptide Genscript Custom designed Synthesized, Ac-AEEEACCPGCC-NH2 Commercial assay or kit Amaxa Cell Line Nucleofector Kit V Lonza Cat#:VCA-1003 Commercial assay or kit Ingenio Electroporation Kit Mirus Cat#: MIR 50118 Commercial assay or kit Lipofectamine RNAiMax Thermo Fisher Cat#:13778075 Chemical compound, drug FlAsH-EDT2 Thermo Fisher Cat#:T34561 Chemical compound, drug 1,2-Ethanedithiol (EDT) Alfa Aesar Cat#:540-63-6 Chemical compound, drug ZM447439 Enzo Life Sciences Cat#:BML-EI373 Chemical compound, drug Paclitaxel (Taxol) Enzo Life Sciences Cat#:BML-T104 Chemical compound, drug 5-iodotubercidin (5-ITu) Enzo Life Sciences Cat#:BML-EI29 Chemical compound, drug S-Trityl-L-cysteine Sigma Aldrich Cat#:164739–5G Chemical compound, drug Alexa Fluor 488 Thermo Fisher Cat#:A20000 Chemical compound, drug Sodium 2- mercaptoethanesulfonate Sigma Aldrich Cat#:M1511 Software, algorithm Interactive kinetochore FLIM-FRET analysis GUI (MATLAB 2016) This paper http://doi.org/10.5281/zenodo.1198705; copy archived at https://github.com/ elifesciences-publications/FLIMInteractive-Data-Analysis Software, algorithm Aurora B concentration at NDC80 analysis (Python 3) This paper http://doi.org/10.5281/zenodo.1198702; copy archived at https://github.com/ elifesciences-publications/Aurora ConcentrationAnalysis Software, algorithm CAMPARI (v2) Pappu Lab http://campari.sourceforge.net /V2/index.html Software, algorithm Rosetta 3.8 RosettaCommons RRID:SCR_015701 Other 25 mm #1.5 poly-D-lysine coated round coverglass neuVitro Cat#:GG-25–1.5-pdl Other FluoroBrite DMEM Thermo Fisher Cat#:A1896701 Other Microtubule structure Zhang et al. (2015) PDB 3JAS Other Human NDC80 bonsai decorated tubulin dimer Alushin et al. (2010) PDB 3IZ0 Other mTurquoise structure Stetten et al. (unpublished) PDB 4B5Y Yoo et al. eLife 2018;7:e36392.

    Selection:

    Article Title: Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments
    Article Snippet: .. Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) U2OS ATCC HTB-96 Transfected construct (Homo sapiens) pBABE-puro mTurquoise2-Nuf2 this paper Nuf2 N-terminally labeled with mTurquoise2; in retroviral vector with puromycin selection marker Transfected construct (Homo sapiens) pBABE-hygro mTurquoise2-Nuf2 this paper Same as above, but with hygromycin selection marker Transfected construct (Homo sapiens) pBABE-blast mTurquoise2-Nuf2 this paper Same as above, but with blasticidin marker Transfected construct (Homo sapiens) pBABE-blast Aurora B FRET sensor (mTurquoise2/YPet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) Nuf2-targeted Aurora B FRET sensor (mTurquoise2/Ypet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) mTurquoise2-TC this paper mTurquoise2 with tetracysteine motif at the C-terminus Transfected construct (Homo sapiens) WT-Hec1-LSSmOrange this paper modified from WT-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9A-Hec1-LSSmOrange this paper modified from 9A-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 2D(S44,55D)-Hec1 -LSSmOrange this paper modified from 2D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9D-Hec1-LSSmOrange this paper modified from 9D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) INCENP-mCherry other Gift from Michael Lampson Recombinant DNA reagent pSpCas9(BB) 2A-GFP (pX458) Ran et al. (2013) Addgene: #48138 Continued on next page Yoo et al. eLife 2018;7:e36392. .. DOI: https://doi.org/10.7554/eLife.36392 17 of 34 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Sequence-based reagent Donor single-stranded DNA for TC tag insertion at the C-terminus of TUBB IDT ssDNA: cgtctctgagtatcagcagtacca ggatgccaccgcagaagaggaggaggattt cggtgaggaggccgaagaggaggcctGCT GTCCCGGCTGTTGctaaggcagagcccc catcacctcaggcttctcagttcccttagccgtc ttactcaactgcccctttcctctccctcaga; sgRNA target sequence: GAGGCCGAA GAGGAGGCCTA Sequence-based reagent Hec1 siRNA Qiagen Cat#: SI02653567 Peptide, recombinant protein TC-peptide Genscript Custom designed Synthesized, Ac-AEEEACCPGCC-NH2 Commercial assay or kit Amaxa Cell Line Nucleofector Kit V Lonza Cat#:VCA-1003 Commercial assay or kit Ingenio Electroporation Kit Mirus Cat#: MIR 50118 Commercial assay or kit Lipofectamine RNAiMax Thermo Fisher Cat#:13778075 Chemical compound, drug FlAsH-EDT2 Thermo Fisher Cat#:T34561 Chemical compound, drug 1,2-Ethanedithiol (EDT) Alfa Aesar Cat#:540-63-6 Chemical compound, drug ZM447439 Enzo Life Sciences Cat#:BML-EI373 Chemical compound, drug Paclitaxel (Taxol) Enzo Life Sciences Cat#:BML-T104 Chemical compound, drug 5-iodotubercidin (5-ITu) Enzo Life Sciences Cat#:BML-EI29 Chemical compound, drug S-Trityl-L-cysteine Sigma Aldrich Cat#:164739–5G Chemical compound, drug Alexa Fluor 488 Thermo Fisher Cat#:A20000 Chemical compound, drug Sodium 2- mercaptoethanesulfonate Sigma Aldrich Cat#:M1511 Software, algorithm Interactive kinetochore FLIM-FRET analysis GUI (MATLAB 2016) This paper http://doi.org/10.5281/zenodo.1198705; copy archived at https://github.com/ elifesciences-publications/FLIMInteractive-Data-Analysis Software, algorithm Aurora B concentration at NDC80 analysis (Python 3) This paper http://doi.org/10.5281/zenodo.1198702; copy archived at https://github.com/ elifesciences-publications/Aurora ConcentrationAnalysis Software, algorithm CAMPARI (v2) Pappu Lab http://campari.sourceforge.net /V2/index.html Software, algorithm Rosetta 3.8 RosettaCommons RRID:SCR_015701 Other 25 mm #1.5 poly-D-lysine coated round coverglass neuVitro Cat#:GG-25–1.5-pdl Other FluoroBrite DMEM Thermo Fisher Cat#:A1896701 Other Microtubule structure Zhang et al. (2015) PDB 3JAS Other Human NDC80 bonsai decorated tubulin dimer Alushin et al. (2010) PDB 3IZ0 Other mTurquoise structure Stetten et al. (unpublished) PDB 4B5Y Yoo et al. eLife 2018;7:e36392.

    Marker:

    Article Title: Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments
    Article Snippet: .. Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) U2OS ATCC HTB-96 Transfected construct (Homo sapiens) pBABE-puro mTurquoise2-Nuf2 this paper Nuf2 N-terminally labeled with mTurquoise2; in retroviral vector with puromycin selection marker Transfected construct (Homo sapiens) pBABE-hygro mTurquoise2-Nuf2 this paper Same as above, but with hygromycin selection marker Transfected construct (Homo sapiens) pBABE-blast mTurquoise2-Nuf2 this paper Same as above, but with blasticidin marker Transfected construct (Homo sapiens) pBABE-blast Aurora B FRET sensor (mTurquoise2/YPet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) Nuf2-targeted Aurora B FRET sensor (mTurquoise2/Ypet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) mTurquoise2-TC this paper mTurquoise2 with tetracysteine motif at the C-terminus Transfected construct (Homo sapiens) WT-Hec1-LSSmOrange this paper modified from WT-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9A-Hec1-LSSmOrange this paper modified from 9A-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 2D(S44,55D)-Hec1 -LSSmOrange this paper modified from 2D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9D-Hec1-LSSmOrange this paper modified from 9D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) INCENP-mCherry other Gift from Michael Lampson Recombinant DNA reagent pSpCas9(BB) 2A-GFP (pX458) Ran et al. (2013) Addgene: #48138 Continued on next page Yoo et al. eLife 2018;7:e36392. .. DOI: https://doi.org/10.7554/eLife.36392 17 of 34 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Sequence-based reagent Donor single-stranded DNA for TC tag insertion at the C-terminus of TUBB IDT ssDNA: cgtctctgagtatcagcagtacca ggatgccaccgcagaagaggaggaggattt cggtgaggaggccgaagaggaggcctGCT GTCCCGGCTGTTGctaaggcagagcccc catcacctcaggcttctcagttcccttagccgtc ttactcaactgcccctttcctctccctcaga; sgRNA target sequence: GAGGCCGAA GAGGAGGCCTA Sequence-based reagent Hec1 siRNA Qiagen Cat#: SI02653567 Peptide, recombinant protein TC-peptide Genscript Custom designed Synthesized, Ac-AEEEACCPGCC-NH2 Commercial assay or kit Amaxa Cell Line Nucleofector Kit V Lonza Cat#:VCA-1003 Commercial assay or kit Ingenio Electroporation Kit Mirus Cat#: MIR 50118 Commercial assay or kit Lipofectamine RNAiMax Thermo Fisher Cat#:13778075 Chemical compound, drug FlAsH-EDT2 Thermo Fisher Cat#:T34561 Chemical compound, drug 1,2-Ethanedithiol (EDT) Alfa Aesar Cat#:540-63-6 Chemical compound, drug ZM447439 Enzo Life Sciences Cat#:BML-EI373 Chemical compound, drug Paclitaxel (Taxol) Enzo Life Sciences Cat#:BML-T104 Chemical compound, drug 5-iodotubercidin (5-ITu) Enzo Life Sciences Cat#:BML-EI29 Chemical compound, drug S-Trityl-L-cysteine Sigma Aldrich Cat#:164739–5G Chemical compound, drug Alexa Fluor 488 Thermo Fisher Cat#:A20000 Chemical compound, drug Sodium 2- mercaptoethanesulfonate Sigma Aldrich Cat#:M1511 Software, algorithm Interactive kinetochore FLIM-FRET analysis GUI (MATLAB 2016) This paper http://doi.org/10.5281/zenodo.1198705; copy archived at https://github.com/ elifesciences-publications/FLIMInteractive-Data-Analysis Software, algorithm Aurora B concentration at NDC80 analysis (Python 3) This paper http://doi.org/10.5281/zenodo.1198702; copy archived at https://github.com/ elifesciences-publications/Aurora ConcentrationAnalysis Software, algorithm CAMPARI (v2) Pappu Lab http://campari.sourceforge.net /V2/index.html Software, algorithm Rosetta 3.8 RosettaCommons RRID:SCR_015701 Other 25 mm #1.5 poly-D-lysine coated round coverglass neuVitro Cat#:GG-25–1.5-pdl Other FluoroBrite DMEM Thermo Fisher Cat#:A1896701 Other Microtubule structure Zhang et al. (2015) PDB 3JAS Other Human NDC80 bonsai decorated tubulin dimer Alushin et al. (2010) PDB 3IZ0 Other mTurquoise structure Stetten et al. (unpublished) PDB 4B5Y Yoo et al. eLife 2018;7:e36392.

    Modification:

    Article Title: Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments
    Article Snippet: .. Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) U2OS ATCC HTB-96 Transfected construct (Homo sapiens) pBABE-puro mTurquoise2-Nuf2 this paper Nuf2 N-terminally labeled with mTurquoise2; in retroviral vector with puromycin selection marker Transfected construct (Homo sapiens) pBABE-hygro mTurquoise2-Nuf2 this paper Same as above, but with hygromycin selection marker Transfected construct (Homo sapiens) pBABE-blast mTurquoise2-Nuf2 this paper Same as above, but with blasticidin marker Transfected construct (Homo sapiens) pBABE-blast Aurora B FRET sensor (mTurquoise2/YPet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) Nuf2-targeted Aurora B FRET sensor (mTurquoise2/Ypet) this paper modified from Addgene #45215; Fuller et al. (2008) Transfected construct (Homo sapiens) mTurquoise2-TC this paper mTurquoise2 with tetracysteine motif at the C-terminus Transfected construct (Homo sapiens) WT-Hec1-LSSmOrange this paper modified from WT-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9A-Hec1-LSSmOrange this paper modified from 9A-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 2D(S44,55D)-Hec1 -LSSmOrange this paper modified from 2D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) 9D-Hec1-LSSmOrange this paper modified from 9D-Hec1-GFP from Jennifer DeLuca Transfected construct (Homo sapiens) INCENP-mCherry other Gift from Michael Lampson Recombinant DNA reagent pSpCas9(BB) 2A-GFP (pX458) Ran et al. (2013) Addgene: #48138 Continued on next page Yoo et al. eLife 2018;7:e36392. .. DOI: https://doi.org/10.7554/eLife.36392 17 of 34 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Sequence-based reagent Donor single-stranded DNA for TC tag insertion at the C-terminus of TUBB IDT ssDNA: cgtctctgagtatcagcagtacca ggatgccaccgcagaagaggaggaggattt cggtgaggaggccgaagaggaggcctGCT GTCCCGGCTGTTGctaaggcagagcccc catcacctcaggcttctcagttcccttagccgtc ttactcaactgcccctttcctctccctcaga; sgRNA target sequence: GAGGCCGAA GAGGAGGCCTA Sequence-based reagent Hec1 siRNA Qiagen Cat#: SI02653567 Peptide, recombinant protein TC-peptide Genscript Custom designed Synthesized, Ac-AEEEACCPGCC-NH2 Commercial assay or kit Amaxa Cell Line Nucleofector Kit V Lonza Cat#:VCA-1003 Commercial assay or kit Ingenio Electroporation Kit Mirus Cat#: MIR 50118 Commercial assay or kit Lipofectamine RNAiMax Thermo Fisher Cat#:13778075 Chemical compound, drug FlAsH-EDT2 Thermo Fisher Cat#:T34561 Chemical compound, drug 1,2-Ethanedithiol (EDT) Alfa Aesar Cat#:540-63-6 Chemical compound, drug ZM447439 Enzo Life Sciences Cat#:BML-EI373 Chemical compound, drug Paclitaxel (Taxol) Enzo Life Sciences Cat#:BML-T104 Chemical compound, drug 5-iodotubercidin (5-ITu) Enzo Life Sciences Cat#:BML-EI29 Chemical compound, drug S-Trityl-L-cysteine Sigma Aldrich Cat#:164739–5G Chemical compound, drug Alexa Fluor 488 Thermo Fisher Cat#:A20000 Chemical compound, drug Sodium 2- mercaptoethanesulfonate Sigma Aldrich Cat#:M1511 Software, algorithm Interactive kinetochore FLIM-FRET analysis GUI (MATLAB 2016) This paper http://doi.org/10.5281/zenodo.1198705; copy archived at https://github.com/ elifesciences-publications/FLIMInteractive-Data-Analysis Software, algorithm Aurora B concentration at NDC80 analysis (Python 3) This paper http://doi.org/10.5281/zenodo.1198702; copy archived at https://github.com/ elifesciences-publications/Aurora ConcentrationAnalysis Software, algorithm CAMPARI (v2) Pappu Lab http://campari.sourceforge.net /V2/index.html Software, algorithm Rosetta 3.8 RosettaCommons RRID:SCR_015701 Other 25 mm #1.5 poly-D-lysine coated round coverglass neuVitro Cat#:GG-25–1.5-pdl Other FluoroBrite DMEM Thermo Fisher Cat#:A1896701 Other Microtubule structure Zhang et al. (2015) PDB 3JAS Other Human NDC80 bonsai decorated tubulin dimer Alushin et al. (2010) PDB 3IZ0 Other mTurquoise structure Stetten et al. (unpublished) PDB 4B5Y Yoo et al. eLife 2018;7:e36392.



    Similar Products

    88
    Addgene inc blasticidin marker transfected construct
    Blasticidin Marker Transfected Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/blasticidin+marker+transfected+construct/untargeted+Aurora+B+FRET+sensor+Kif2+substrate+(Plasmid+%2345215)/10__7554_slash_elife__36392-259-71-87
    Average 88 stars, based on 1 article reviews
    blasticidin marker transfected construct - by Bioz Stars, 2026-09
    88/100 stars
      Buy from Supplier

    Image Search Results